ID: 991469657_991469658

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 991469657 991469658
Species Human (GRCh38) Human (GRCh38)
Location 5:66954544-66954566 5:66954569-66954591
Sequence CCTACACTCTGATAGGGGAAGAC ACAATAAATAAATATATGTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 11, 3: 165, 4: 1592}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!