ID: 991570673_991570685

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 991570673 991570685
Species Human (GRCh38) Human (GRCh38)
Location 5:68050229-68050251 5:68050280-68050302
Sequence CCAGGACAGAATTCCTGGGCCAG CCAGATTGCCCAGGCATCAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!