ID: 991589001_991589011

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 991589001 991589011
Species Human (GRCh38) Human (GRCh38)
Location 5:68229547-68229569 5:68229596-68229618
Sequence CCACATGCAGTTTTGTTTTGTGG CAGGGTAGACAGAGGGTGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 343} {0: 1, 1: 0, 2: 0, 3: 27, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!