ID: 991769411_991769417

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 991769411 991769417
Species Human (GRCh38) Human (GRCh38)
Location 5:70026588-70026610 5:70026603-70026625
Sequence CCTCATGCCTGTAATCCCGGCAG CCCGGCAGTTTGGGAGAGTCGGG
Strand - +
Off-target summary {0: 2, 1: 22, 2: 1039, 3: 2620, 4: 3427} {0: 2, 1: 0, 2: 6, 3: 242, 4: 8552}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!