ID: 991851455_991851461

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 991851455 991851461
Species Human (GRCh38) Human (GRCh38)
Location 5:70925876-70925898 5:70925891-70925913
Sequence CCTGGAAGGTTCAGGCCTTGGAA CCTTGGAAGGCTCAGGGAGGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 159} {0: 2, 1: 0, 2: 82, 3: 3162, 4: 50305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!