ID: 991971767_991971775

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 991971767 991971775
Species Human (GRCh38) Human (GRCh38)
Location 5:72148349-72148371 5:72148375-72148397
Sequence CCCACAGAAGGGCCCATACCCAG GATCTTTGCTGAGAGCATCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 168} {0: 1, 1: 0, 2: 0, 3: 15, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!