ID: 992041427_992041432

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 992041427 992041432
Species Human (GRCh38) Human (GRCh38)
Location 5:72837072-72837094 5:72837094-72837116
Sequence CCTTTACCCATTACCCAATTGCA AAAGCCACTTCCACATTTTTAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 14, 3: 182, 4: 767} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!