ID: 992059036_992059037

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 992059036 992059037
Species Human (GRCh38) Human (GRCh38)
Location 5:73023725-73023747 5:73023738-73023760
Sequence CCAAACACATTTATTTAACACAC TTTAACACACAGAAATATGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 415} {0: 1, 1: 0, 2: 1, 3: 25, 4: 402}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!