ID: 992202438_992202444

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 992202438 992202444
Species Human (GRCh38) Human (GRCh38)
Location 5:74397663-74397685 5:74397685-74397707
Sequence CCAAATTCCCTCTTCTTATAAGG GATATCAGTTATACAGACTGGGG
Strand - +
Off-target summary {0: 2, 1: 100, 2: 425, 3: 893, 4: 1467} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!