ID: 992243786_992243791

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 992243786 992243791
Species Human (GRCh38) Human (GRCh38)
Location 5:74796697-74796719 5:74796728-74796750
Sequence CCCAGCCTGAATCTTTTTTTTTT TCATTTATACTGAAGGACCATGG
Strand - +
Off-target summary {0: 2, 1: 23, 2: 216, 3: 1629, 4: 10623} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!