ID: 992321069_992321073

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 992321069 992321073
Species Human (GRCh38) Human (GRCh38)
Location 5:75613452-75613474 5:75613480-75613502
Sequence CCTTTCCTAGGTACAGGGATGCT CTGCATATATAAATGAAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 135} {0: 1, 1: 0, 2: 2, 3: 16, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!