ID: 992327111_992327115

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 992327111 992327115
Species Human (GRCh38) Human (GRCh38)
Location 5:75671098-75671120 5:75671134-75671156
Sequence CCATAAATTTCTTCTAGCAGTAG CTATGATGATGGTGGTGACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 217} {0: 1, 1: 0, 2: 3, 3: 34, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!