ID: 992368182_992368186

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 992368182 992368186
Species Human (GRCh38) Human (GRCh38)
Location 5:76114608-76114630 5:76114648-76114670
Sequence CCTGATTCCCTCAGAAAAGACAG CTTCTTTGAGCTTTCTTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 229} {0: 1, 1: 1, 2: 4, 3: 52, 4: 525}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!