ID: 992488023_992488027

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 992488023 992488027
Species Human (GRCh38) Human (GRCh38)
Location 5:77214378-77214400 5:77214410-77214432
Sequence CCGTTTTCCCTCCATTCATACAG ATTTGTTCATTCAGTATTTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 73, 4: 574}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!