ID: 992560304_992560311

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 992560304 992560311
Species Human (GRCh38) Human (GRCh38)
Location 5:77945856-77945878 5:77945876-77945898
Sequence CCACCTCTGCAGCTCCAATGTGA TGACCTCAGCCCAGGGTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 227} {0: 1, 1: 1, 2: 2, 3: 35, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!