ID: 992570460_992570465

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 992570460 992570465
Species Human (GRCh38) Human (GRCh38)
Location 5:78050109-78050131 5:78050133-78050155
Sequence CCTGGGACCCTCTACCTGGAAGG ACTTTCTCCAGAGACCCACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 212} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!