ID: 992583321_992583326

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 992583321 992583326
Species Human (GRCh38) Human (GRCh38)
Location 5:78204771-78204793 5:78204786-78204808
Sequence CCCTGTCACTGAGGCAGAGAAGG AGAGAAGGGAGGATAGAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 301} {0: 1, 1: 0, 2: 14, 3: 135, 4: 1391}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!