ID: 992671293_992671296

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 992671293 992671296
Species Human (GRCh38) Human (GRCh38)
Location 5:79063619-79063641 5:79063636-79063658
Sequence CCAGGTAGATCCAGCCGTGAGCT TGAGCTCTGATTTCTCCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54} {0: 1, 1: 0, 2: 1, 3: 26, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!