ID: 992674518_992674527

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 992674518 992674527
Species Human (GRCh38) Human (GRCh38)
Location 5:79092333-79092355 5:79092386-79092408
Sequence CCCACCTCCCTCAATCCCCACAA TCTTCATATGTTATTATAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 55, 4: 654} {0: 1, 1: 0, 2: 3, 3: 28, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!