ID: 992804132_992804142

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 992804132 992804142
Species Human (GRCh38) Human (GRCh38)
Location 5:80320246-80320268 5:80320286-80320308
Sequence CCCACCATCTCCAAAACCGTTAA ATCAAGAATATCTGGACCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 156} {0: 1, 1: 0, 2: 0, 3: 38, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!