ID: 992813063_992813071

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 992813063 992813071
Species Human (GRCh38) Human (GRCh38)
Location 5:80408353-80408375 5:80408371-80408393
Sequence CCCCTCCTGGAGCCTGAAGGGCC GGGCCAGACCGGACTGGACCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 34, 4: 249} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!