ID: 992824738_992824744

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 992824738 992824744
Species Human (GRCh38) Human (GRCh38)
Location 5:80537514-80537536 5:80537546-80537568
Sequence CCCACAAAGGTACTTTTATCCAT TCAAAATCGGTGTTTCAGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 11, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!