ID: 992867754_992867756

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 992867754 992867756
Species Human (GRCh38) Human (GRCh38)
Location 5:80974671-80974693 5:80974692-80974714
Sequence CCACCTTGTGAGTTCTTGATCTG TGACTTCATCTATCTTCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 205} {0: 1, 1: 0, 2: 0, 3: 17, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!