ID: 992888772_992888776

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 992888772 992888776
Species Human (GRCh38) Human (GRCh38)
Location 5:81185074-81185096 5:81185117-81185139
Sequence CCAGCTAAGAGCTCGTGAAATCA CACCCACCTGTGGGAAGTTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 16, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!