ID: 993034853_993034860

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 993034853 993034860
Species Human (GRCh38) Human (GRCh38)
Location 5:82745502-82745524 5:82745542-82745564
Sequence CCAAAACTGTCTCCAGACATGGC CAAAATTGTCACCATAACACTGG
Strand - +
Off-target summary {0: 5, 1: 41, 2: 356, 3: 834, 4: 1342} {0: 1, 1: 0, 2: 1, 3: 14, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!