ID: 993508244_993508246

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 993508244 993508246
Species Human (GRCh38) Human (GRCh38)
Location 5:88737855-88737877 5:88737906-88737928
Sequence CCAAATTTTATACTCTAGAAAAT AGCTTTATTAAATTTGTGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 62, 4: 750} {0: 1, 1: 0, 2: 1, 3: 37, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!