ID: 993902062_993902068

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 993902062 993902068
Species Human (GRCh38) Human (GRCh38)
Location 5:93591300-93591322 5:93591324-93591346
Sequence CCCCTGGTCACCTAGCTTTGTCA CACAACCCCCTAGTTGATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114} {0: 1, 1: 0, 2: 0, 3: 2, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!