ID: 993978866_993978872

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 993978866 993978872
Species Human (GRCh38) Human (GRCh38)
Location 5:94516955-94516977 5:94516983-94517005
Sequence CCGGGCATGGTAGTGCATGCCTG CCAGCTACTTAGGAGGCCTGAGG
Strand - +
Off-target summary No data {0: 2, 1: 42, 2: 304, 3: 1181, 4: 5196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!