ID: 994028581_994028590

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 994028581 994028590
Species Human (GRCh38) Human (GRCh38)
Location 5:95114388-95114410 5:95114423-95114445
Sequence CCTTCGACCTGCCCTTGGGACAG TGCCCTGAAGGGTGAGTAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 130} {0: 1, 1: 5, 2: 157, 3: 350, 4: 571}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!