ID: 994041961_994041965

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 994041961 994041965
Species Human (GRCh38) Human (GRCh38)
Location 5:95268832-95268854 5:95268875-95268897
Sequence CCTTAGCTGCACTGAGAGGCAAA CTTTCATCCATCGCTGGGTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 8, 2: 10, 3: 64, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!