ID: 994177455_994177457

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 994177455 994177457
Species Human (GRCh38) Human (GRCh38)
Location 5:96726966-96726988 5:96726992-96727014
Sequence CCCATCATGGACTTTCTGTAGGC GCTGCCCATCAGCCACATTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!