ID: 994200079_994200083

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 994200079 994200083
Species Human (GRCh38) Human (GRCh38)
Location 5:96963598-96963620 5:96963650-96963672
Sequence CCTCTTAAAGCCTAGGATTGGAC ATTGATTAAAGCAAGTTACAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 20, 4: 110} {0: 1, 1: 2, 2: 30, 3: 188, 4: 811}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!