ID: 994353893_994353898

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 994353893 994353898
Species Human (GRCh38) Human (GRCh38)
Location 5:98774099-98774121 5:98774119-98774141
Sequence CCGCCGCTGCCGCCGCCGAGGTT GTTGAGCAGCGCCGCAGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 101, 4: 771} {0: 1, 1: 0, 2: 1, 3: 11, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!