ID: 994670258_994670269

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 994670258 994670269
Species Human (GRCh38) Human (GRCh38)
Location 5:102755130-102755152 5:102755164-102755186
Sequence CCGGGGAGGGACTGAGACCTGCC GGGCGAGCGGCGGACCCGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 407} {0: 1, 1: 0, 2: 3, 3: 26, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!