ID: 995041492_995041499

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 995041492 995041499
Species Human (GRCh38) Human (GRCh38)
Location 5:107593291-107593313 5:107593342-107593364
Sequence CCAGCACAGGACCGGACTTCAGT GAGAACAAATCTGTTCTTTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 22, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!