ID: 995074310_995074314

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 995074310 995074314
Species Human (GRCh38) Human (GRCh38)
Location 5:107963707-107963729 5:107963745-107963767
Sequence CCTCCATTTACTATAAAATACAA CACATTTAGCTCTGGGAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 66, 4: 1167} {0: 1, 1: 0, 2: 1, 3: 7, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!