ID: 995313476_995313481

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 995313476 995313481
Species Human (GRCh38) Human (GRCh38)
Location 5:110739364-110739386 5:110739393-110739415
Sequence CCAGTGGCGGCGGCGGCAGTGTG CAGAGCAGTGGTGAGAAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 346} {0: 1, 1: 0, 2: 1, 3: 56, 4: 554}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!