ID: 995342252_995342257

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 995342252 995342257
Species Human (GRCh38) Human (GRCh38)
Location 5:111073018-111073040 5:111073033-111073055
Sequence CCGAGAGGTGCCTGGGCTCCGGG GCTCCGGGACGCCGCCGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 262} {0: 1, 1: 0, 2: 2, 3: 15, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!