ID: 995398662_995398669

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 995398662 995398669
Species Human (GRCh38) Human (GRCh38)
Location 5:111716805-111716827 5:111716836-111716858
Sequence CCAGGTCCTCTGTCCCAGGAAGA TTATCTACAAGCCCCTGACTGGG
Strand - +
Off-target summary {0: 1, 1: 46, 2: 688, 3: 717, 4: 685} {0: 14, 1: 486, 2: 645, 3: 496, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!