ID: 995461743_995461753

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 995461743 995461753
Species Human (GRCh38) Human (GRCh38)
Location 5:112410719-112410741 5:112410768-112410790
Sequence CCCATTGCCCTTATCGCCCAAGA AAGACTCAAGGGAAGTCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 49} {0: 1, 1: 0, 2: 4, 3: 16, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!