ID: 995650388_995650397

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 995650388 995650397
Species Human (GRCh38) Human (GRCh38)
Location 5:114362289-114362311 5:114362321-114362343
Sequence CCCGCACCTCGCGCACCAGCAGC GCGGCAGCAGCCCATGCCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 277} {0: 1, 1: 0, 2: 1, 3: 25, 4: 347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!