ID: 995656235_995656238

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 995656235 995656238
Species Human (GRCh38) Human (GRCh38)
Location 5:114429551-114429573 5:114429587-114429609
Sequence CCCAGTCTGTGGCTTGTACTTTG GAAGCTTTTAAGTTTAATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 22, 3: 255, 4: 1206} {0: 1, 1: 1, 2: 7, 3: 50, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!