ID: 995762607_995762613

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 995762607 995762613
Species Human (GRCh38) Human (GRCh38)
Location 5:115579308-115579330 5:115579335-115579357
Sequence CCTTTAGAGATCCATCAATTCAA TTCATTTCACAGATAAAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 183} {0: 1, 1: 0, 2: 9, 3: 50, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!