ID: 995794623_995794626

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 995794623 995794626
Species Human (GRCh38) Human (GRCh38)
Location 5:115928626-115928648 5:115928647-115928669
Sequence CCAGCCAGAGCAGGATCTTTCAA AACCTCTGCACTTACATTTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!