ID: 996021536_996021540

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 996021536 996021540
Species Human (GRCh38) Human (GRCh38)
Location 5:118595956-118595978 5:118595971-118595993
Sequence CCTGTCTTCACACAGCCTCTCAC CCTCTCACAGTGGTGTGGCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!