ID: 996066287_996066289

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 996066287 996066289
Species Human (GRCh38) Human (GRCh38)
Location 5:119083169-119083191 5:119083196-119083218
Sequence CCTGGCTAATTTTGTATATACAC ATATATTTTTTAGTAGAGATGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 24, 3: 1089, 4: 19212} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!