ID: 996304549_996304553

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 996304549 996304553
Species Human (GRCh38) Human (GRCh38)
Location 5:122032176-122032198 5:122032197-122032219
Sequence CCTCCTCCCTTCAGTATATGTGA GAAATGTAGTGAAATTTATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 211} {0: 1, 1: 0, 2: 2, 3: 21, 4: 399}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!