ID: 996313801_996313805

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 996313801 996313805
Species Human (GRCh38) Human (GRCh38)
Location 5:122138319-122138341 5:122138337-122138359
Sequence CCTTACCTTGCATTTCACATGCA ATGCAAACCCACAATAAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 225} {0: 1, 1: 0, 2: 3, 3: 13, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!