ID: 996391851_996391861

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 996391851 996391861
Species Human (GRCh38) Human (GRCh38)
Location 5:122970858-122970880 5:122970907-122970929
Sequence CCCTCCTCTTTTCTCATCTCTGT TCCAGTACACCCTTGTGTTAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 134, 4: 1210} {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!