ID: 996695240_996695242

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 996695240 996695242
Species Human (GRCh38) Human (GRCh38)
Location 5:126387138-126387160 5:126387160-126387182
Sequence CCATATGACTGAAGTCCATATTT TTGATGACCTTAAGTAAACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 208} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!